Why do complex organisms need specialized cells

Answers

Answer 1

Answer:

without them complex organisms cannot perform different functions

Explanation:

apex

Answer 2

Complex organisms require specialized cells to perform specific functions efficiently, allowing for the division of labor and optimized functioning of the organism.

Complex organisms, such as humans, consist of numerous specialized cells to support their intricate physiological and functional requirements.

Several reasons explain why specialized cells are essential in complex organisms:

Division of Labor: Specialized cells allow for a division of labor within an organism.

Each type of cell is uniquely adapted to perform specific functions, such as nerve cells transmitting signals or red blood cells carrying oxygen.

This specialization ensures that each task is performed efficiently and accurately.

Increased Efficiency: Specialized cells are highly efficient at their designated functions.

For instance, muscle cells contract with great force, while absorptive cells in the intestines have structures that maximize nutrient absorption.

This efficiency optimizes the overall functioning of the organism.

Adaptation to Environment: Complex organisms encounter diverse and often changing environments.

Specialized cells can adapt to these environmental variations. For example, skin cells can protect the body from external threats, while immune cells can fight infections.

Energy Conservation: Specialized cells can conserve energy by performing specific tasks.

This energy efficiency is crucial for maintaining the overall health and longevity of the organism.

Structural Organization: Specialized cells contribute to the structural organization of tissues and organs.

The arrangement of different cell types into tissues and organs enables the complex coordination of various physiological processes.

Reproduction: Some specialized cells, like germ cells, are essential for reproduction.

They carry genetic information, ensuring the continuation of the species.

Specialized cells are necessary in complex organisms because they enable efficient functioning, adaptation to varying conditions, energy conservation, structural organization, and reproduction.

This specialization is a fundamental aspect of the diversity and success of complex life forms.

For such a more question on organisms

https://brainly.com/question/17259533

#SPJ3


Related Questions

40 POINTS!!! NEED GOOD ANSWERS!!!
What is the correct definition of conflict? A. A disagreement between people with opposing viewpoints. B. A negative and unjustly formed opinion, usually against people of a different racial, religious, or cultural group. C. Using another person to help reach a solution that is acceptable to both sides. D. Discussing problems face-to-face in order to reach a solution.

Answers

The statement (A) is correct. A disagreement between people with opposing viewpoints.

What do you mean by conflicts?

A conflict is a struggle and a clash of interest, opinion, or even principles. Conflict will always be found in society; as the basis of conflict may vary to be personal, racial, class, caste, political and international.

Moreover, conflict is serious disagreement and argument about something important. If two people or groups are in conflict, they have had a serious disagreement or argument and have not yet reached agreement. Try to keep any conflict between you and your ex-partner to a minimum.

Therefore, the opposing force created, the conflict within the story generally comes in four basic types: Conflict with the self, Conflict with others, Conflict with the environment and Conflict with the supernatural.

Learn more about conflicts:

https://brainly.com/question/12832202

#SPJ2

The function of the eardrum is to

Answers

Answer:

A. carry the sound energy to the brain. B. collect the sound waves. C. amplify the received sound. D. vibrate with the frequency of the received sound.

These are the choices right? Well, I think that its D. vibrate with the frequency of the received sound. I hope its correct bc im on the same question.. good luck:) {MARK BRAINLIEST!!!}

The two immediate functions of the eardrum are auditory and protective.

The eardrum is the membrane of the middle year which vibrates in response to sound waves; also the tympanic membrane.

How can we protect(s) the eardrum from dirt?

The earwax is the part of the ear that protects the eardrums from dirt and infections. These are produced by glands in the skin linings of the ear canal responsible for protecting the ear. The ear is divided into three sections: Outer, middle, and inner ear.

Earwax is found in the outer ear section lining the ear canal protecting the passage to the eardrum.

Earwax when removed in excessive amounts may cause the ears to develop certain infections and might cause the infections of the other sections of the ears as well.

Thus, this could be the answer.

To learn more about eardrum  click here:

https://brainly.com/question/13740969

#SPJ2

what are two ways variation in the trait could be introduced into the population?

Answers

A single mutation can have a large effect, but in many cases, evolutionary change is based on the accumulation of many mutations. I hope this help you

Answer:

i sai sai

Explanation:

sia sia sai In a running relay, each runner ran an equal part of the total distance.  Joseph and 3 othe

The four principles of natural selection

Answers

1) Variation: there needs to be a difference in the individuals within a population

2) Inheritance: These variable traits must be able to be passed down genetically

3) Growth rate: There needs to be a growth rate that requires a struggle for resources

4) Survival rate: There needs to be a difference in survival rate for the different variation types... certain variations will live

Final answer:

The four principles of natural selection are variation, inheritance, high rate of population growth, and differential survival and reproduction. This means members of a species are variable, part of this variation is inheritable, populations produce more offspring than can survive, and those with better survival traits are more likely to pass them on.

Explanation:

The four principles of natural selection are: variation, inheritance, high rate of population growth, and differential survival and reproduction.

The principal of variation means individuals within species are variable. Inheritance means that some of these variations are passed on to offspring. High rate of population growth means that populations produce more offspring than can survive, leading to competition. Lastly, differential survival and reproduction states that individuals with advantageous traits are more likely survive and reproduce than those without these traits.

Combined, these principles drive the process of natural selection, causing species to adapt to their environments over time. In any given environment, the individuals with traits best suited to that environment will have the greatest chances of surviving and passing those traits on to the next generation.

Learn more about Natural Selection here:

https://brainly.com/question/32227158

#SPJ6

How is an egg fertilized in flowering plants?


A.
with sperm


B.
by spores


C.
with an ovule


D.
with embryos

Answers

Answer: A. with sperm

Explanation:

Can a tornado pick up a person and send it to another island?

Answers

Answer: almost imposiable

Explanation: If you do happen to get picked up a tornado the longest time you will stay in it is approximately 5 minutes before it throws you out of it. If you did so happen to be swept in a tornado near a island it is possiable, but tornados over water die very very fast so this is very unlikley.

Hope this helps

Answer:

Nope.

Explanation:

Now I don't know anything about much about tornado's. But I'm pretty sure it won't pick up that person and send it to another island. I don't think the tornado have enough force to throw the person to another island. It will, however, send that person on another area maybe close to the tornado area. But yet again I don't the tornado have the abilty to do that.

need help plzzzzzzzz In this assessment, you will categorize a group of animals by two forms of classification: phylogeny (cladistics) and Linnaean taxonomy. For phylogeny, you will create a cladogram for your groups of animals. For Linnaean classification, you will create a taxonomy chart or concept map that categorizes your species by taxa. Select from the two groups of animals listed below for your project.

Bird Group: Blue Jay, robin, cardinal, finch, and pelican
Insect Group: African honeybee, grasshopper, black widow spider, mosquito, and yellow jacket

Answers

Answer:

Blue Jay

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Passeriformes

Family: Corvidae

Genus: Cyanocitta

Species: C. cristata

Robin

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Passeriformes

Family: Turdidae

Genus: Turdus

Species: T. migratorius

Cardinal

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Passeriformes

Suborder: Passeri

Family: Cardinalidae

Finch

Kingdom: Animalia

Phylum: Chordata

Class: Reptilia

Class: Aves

Order: Passeriformes

Superfamily: Passeroidea

Family: Fringillidae

Pelican

Kingdom: Animalia

Phylum: Chordata

Class: Aves

Order: Pelecaniformes

Family: Pelecanidae

Genus: Pelecanus

Explanation:

I put it into the graph they want, and I got a 100%. (If your in FLVS like me, try to re-word it or put it in a different setting.)

The two groups of animals listed below for your project are as follow:

1. Blue Jay

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesFamily: CorvidaeGenus: CyanocittaSpecies: C. cristata

2. Robin

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesFamily: TurdidaeGenus: TurdusSpecies: T. migratorius

3. Cardinal

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesSuborder: PasseriFamily: Cardinalidae

4. Finch

Kingdom: AnimaliaPhylum: ChordataClass: ReptiliaClass: AvesOrder: PasseriformesSuperfamily: PasseroideaFamily: Fringillidae

Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PelecaniformesFamily: PelecanidaeGenus: Pelecanus

What is animal classification chart?

Kingdom, phylum, class, order, family, genus, and species are the classification levels in order.

Thus, this the answer.

To learn more about animal classification click here:

https://brainly.com/question/24095327

#SPJ2

Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis

Answers

Answer:

Chemosynthesis

Explanation:

Its right trust me

the correct answer is chemosynthesis <3

Solve this Sex-Linked traits practice problem

Answers

We know that hemophilia is a recessive trait, and the only way to express a recessive trait is to have a homozygous mixture. So, the genotypes probably look like this:

BB = normal blood clotting
Bb = carrier for hemophilia
bb = hemophiliac

Because the mother does NOT have hemophilia, we will be using BB x Bb to find out the alleles of their children. Because this is sex-linked traits practice, our alleles will be the following.

normal = X^BY
(uppercase B represents no hemophilia)

X^BX^b

Let’s cross them and see what we get!

X^B Y

X^B | X^BX^B X^BY

X^b | X^BX^b X^bY

As you can see, 0/4 of the females (represented by XX) will have hemophilia. Again, it is only present when there are two recessive alleles and none of them satisfy that.

2/4 of the females will be carriers (X^BX^b).

As for the boys, 1/4 will have normal clotting and 1/4 will have hemophilia. None of the males will simply be carriers.

I hope I helped!
Feel free to ask me for more assistance (if needed); I’ll gladly help! :)



1: Fill in the blanks: The process of
_____is
the scientific term used for water moving across
a semi-permeable membrane. Water tends to
move from the side with a________
concentration of solute to the side of the
membrane with a________
concentration of
solute

Answers

In order: osmosis, higher, lower

Osmosis higher lower

In order from less complex to more complex, which level of organization is directly after tissue?

Answers

Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...

Molecules. The size of molecules varies enormously depending on the type of molecule.

Organelles.

Cells.

Tissues.

Organs.

Organ Systems.

Organism.

Answer:

a

Explanation:

hope it helps

The action by which a plant grows toward sunlight is called _____.


response to stimulus

using energy

reproduction

movement

Answers

Answer: phototropism

Explanation: phototropism is a plant's response to light.

Plants growing toward sunlight is known as tropism, a response to stimuli.

Tropism is the action by which a plant grows toward sunlight. This growth movement is a response to stimuli where the plant or a part of it grows in the direction from which the stimulus originates.

Why do geese fly together in a V formation?

Answers

Explanation:

Geese fly together in a v formation.

Geese fly together because when the first goose flaps it's wings it creates an upward force which make it easier for the second goose to fly.

In this way the force increases and the effort the last goose has to spend to fly decreases a lot.

Hope it helps you.

please mark as brainliest.

Answer:

B. to save energy

Explanation:

ody ssey Unit 3, Assignment 2. Animal behavior and Interdependencies, page 4, under Group Animal Behavior, paragraph 2, from " The lead goose....V formation.....making their flight easier."  

nowhere in my ody ssey unit materials did it mention otherwise or geese again.  

What happens to a virus involved in the lysogenic cycle?

Answers

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.

Answers

Answer:

C. It is caused by a virus, not a bacterium

Explanation:

The answer is C influenza is caused by viruses not a bacterium

viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood

please, answer the question immediately as it is important for my project. the motions of comets and asteroids in our solar system are predictable because they are
1)smaller than planets
2)nearly spherical in shape
3)in orbit around the sun
4)controlled by earth's gravity

Answers

I think its 3)in orbit around the sun

i hope i helped even just a little :)

3) in orbit around the sun.

The motions of comets and asteroids in our solar system are predictable because they are in orbit around the sun.Asteroids are rocky. They come from the inner solar system, where any ice would have been baked off by the sun long ago. Their orbits are fairly predictable. That means new comets can arrive in the inner solar system ,something we have no way of predicting ahead of time.Asteroid revolves around the Sun in elliptical orbits.

Learn more:

brainly.com/question/17717852

Chapter8 lesson 2 cell structure

Answers

Answer:

Can you give me more details about this question?

Answer:

wdym

Explanation:

Which part of a mushroom can you see above the ground?

Answers

Answer:

The correct answer is reproductive part.

Explanation:

The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.

Please
Which process led to the release of large amounts of carbon dioxide at the end of the Devonian period?

A. The breakup of Pangaea
B. The extinction of plant life
C. The melting of glaciers
D. The volcanic activity

Answers

Answer:

The volcanic activity led to the release of large amounts of carbon dioxide at the end of the Devonian period

Explanation:

Devonian period is refereed as the Age of fish. It is also called an era of mass Extinction. During the end of Devonian period most of the terrestrial animals were extinct from Earth. Another big feature of Devonian period was massive volcanic activity which contributed to the release of carbon dioxide in the environment.    

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence

Answers

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

Frost wedging happens when__

Answers

Answer:

Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.

Answer: The correct option is water freezes inside a rock, causing it to break

Explanation:

How does introduced species harm our planet?
Please someone answer this
ASAP!!!

Answers

Introduced species can harm our planet because in some regions of the world we are not prepared for their type of species, which can all in all cause damage.

Answer: alteration of the ecosystem

Explanation:when a new specie is introduced into the ecosystem it may have profound affects in the ecosystem and may also be called an invasive specie.

The affects that it may have on the ecosystem include

1.outcompeting the native specie and sometimes even leading to their extinction because the new specie may be modified in such a way as to have better chances of survival in the ecosystem because of their evolved genetics e.g : the new specie may encounter a native and non evolved specie of the ecosystem and compete with it for survival leading to reduction and even complete eradication of the native specie

A group of environmental activists in West Virginia wants to save a large forest. Which act will help them in this activity?

1. Nature conservancy
2. Toxic substance control act
3. Eastern wilderness areas act
4. Endangered species act

Answers

Answer:

A

Explanation:

Answer: 1. Nature conservancy

Explanation:

Nature conservancy is the process or initiative taken by the human society to conserve the regions of forests and the associated wildlife, fossil fuels, water sources and others. This practice will ensure that the valuable resources will remain available for the present as well as for the future generation of human beings.

On the basis of the above description, nature conservancy is the activity which will help the environmental activists to save the forests.

Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology

Answers

Answer:taxonomy

Explanation:

Modern Taxonomy

Carolus Linnaeus it credited with developing the scientific naming and classification system.

Hope this helps!!

I need help now
Which type of bacteria is shown in the image?
A. bacillus
B. coccus
C. spirillum
D. cholera

Answers

Answer is B bacillus

The bacteria shown in the image are bacillus bacteria. Therefore, option A is correct.

Bacillus bacteria are a group of rod-shaped, gram-positive bacteria that belong to the genus Bacillus. They are characterized by their ability to form endospores, which are dormant structures that allow them to survive in harsh conditions. Bacillus bacteria are widely distributed in nature and can be found in soil, water, and various organic materials.

Some notable species of Bacillus include Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. Therefore, option A is correct.

Learn more about Bacillus bacteria, here:

https://brainly.com/question/11201874

#SPJ4

Mid-ocean ridges are underwater mountainous regions formed by the separation of ___________. A) tsunamis B) tectonic plates C) continental divides D) subatomic particles

Answers

Answer:B, tectonic plates

Explanation:

A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock is accurate?

A. The rock formed from cooling lava.
B. The rock likely came from a pluton.
C. The rock cooled slowly over millions of years.
D. The rock formed within Earth's crust.

Answers

The correct answer is D

The accurate statement about an extrusive igneous rock is that it formed from cooling lava, which cools quickly at the Earth's surface, leading to a finer-grained texture.

Based on the information that a geologist concludes a rock sample is an extrusive igneous rock, the accurate statement about the rock is A. The rock formed from cooling lava. Extrusive igneous rocks such as basalt are formed above the surface when molten rock, known as lava, extrudes onto the Earth's surface and cools quickly. This rapid cooling does not allow large crystals to form, leading to a finer-grained texture, and in some cases, such as with obsidian, a glassy texture due to the extremely rapid cooling.

Option B is incorrect because rocks that come from plutons are intrusive, rather than extrusive, and they cool slowly within the Earth's crust. Option C is incorrect as extrusive igneous rocks do not cool slowly over millions of years. Option D is also incorrect because extrusive igneous rocks form at the Earth's surface, not within the Earth's crust.

The information contained in the table could be used _______________________.

Answers

Can you attach the table so I can see it??

Answer:

A

Explanation:

to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.

Figure 10-4
49
replicate DNA
a
In Figure 10-4. what role does structure A play in mitosis?
b. increase cell
connect to spindled dissolve nuclear
volume
fibers
envelope
Figure 10-5

Answers

Structure A in Figure 10-4 is the centrioles.  role does structure A play in mitosis  is: (c) connect to spindle fibers

Centrioles are paired organelles that are found in the cytoplasm of eukaryotic cells. They are composed of microtubules, which are long, thin filaments that form the structural framework of the cell. During interphase, the centrioles are located near the nucleus and are surrounded by a cloud of protein called the centrosome.

As the cell progresses into mitosis, the centrioles replicate and move to opposite poles of the cell. This process is called centrosome separation. The centrosomes act as organizing centers for the spindle fibers, which are microtubules that extend from the centrosomes and attach to the chromosomes. The spindle fibers play a crucial role in separating the chromosomes during mitosis.

an increase in skin cancer can be traced to a decrease in atmospheric

Answers

Answer:

an increase in skin cancer can be traced to a decrease in atmospheric ozone.

Happy to help

pls mark as Brainliest

Answer: Ozone

Explanation: There is a increase in chance of cancer now a days as compared to earlier time because of ozone depletion.

Due to various types of human activities there are many holes in the ozone due to which harmful ultraviolet rays is entering on earth and there is an increase in the chances o skin cancer.

So, the correct answer is ozone

Other Questions
Need to write a letter about holiday abroad is bad for environment A recent study on the relationship between children's weight and their achievement test scores determined the correlation coefficient to be .9734. Which is the most reasonable conclusion based on the correlation coefficient?A)Children who weigh more score lower on achievement tests.B)As age increases, so do body weight and achievement test scores.C)Children who weigh more spend more time on studying for achievement tests.D)Children should increase their food intake to increase their achievement test scores. This map shows India, which is located in South Asia. Based on its location, the climate in southwestern India is MOST LIKELYA)desert.B)temperate.C)tropical monsoon.D)tropical savannah. What is a private club tabc HURRY ILL GIVE BRAINLIEST!!! Suppose a line has slope m and passes through the point (a, b). Which other point MUST also be on the graph? A)(a + m, b + 1) B)(a + m, b - 1) C)(a + 1, b - m) D)(a + 1, b + m) The company president sets a goal that the percentage of working phones must increase from 30% to atleast 80% by the end of the daya. 3/10+x/x>=8/10b. 3/10+1/x>=8/10c. 3x/10x>=8/10d. 3x+x/10+x>=8/10 Why is there so little wind in the location where the atmosphere circulation cells meet? What is the first step to take to help reduce pollution? A. Donate money to an organization that works to fight water and air pollution. B. Gain information about the current state of the environment and ways to improve it. C. Maintain a clean and healthy home as an example for others to follow. The respect given Henry Purcell by his fellow Englishmen is evidenced by his burial inA. Potters Field.B. Westminster Abbey.C. Buckingham Palace.D. Canterbury Cathedral. Which of the following statements are true about metallic bonds? A. They hold together ionic bonds.B. They bond a metal to a nonmetal. C. They bond identical atoms together. D. They hold together atoms with different electronegative. According to Pennsylvania law, who must wear an approved life jacket while being towed behind a vessel? Find the slope of (1, 2), (-1, -2). Reduce all fractional answers to lowest terms Which of the following plurals is spelled correctly? A - Ponys B - Diaries C - Studees D - Berryes Mi pap quiere que yo no me___cuando maneje.a. distraigasb. distraigoc. distraiga Breathing is called _____. expiration inspiration circulation respiration PLEASE HELP ASAP!!!!!!!!!!!!!!!!!!!!!!!! Colin and Jezebel are employees at Game Zone. They recorded the number of computer games they sold each week for the past 9 weeks. Colin 15 20 21 9 3 16 9 14 17 Jezebel 10 14 20 11 4 26 5 8 20 (a) All of the games sold of which person had the greatest spread? Explain how you know. (b) The middle 50% of the games sold of which person had the least spread? Explain how you know. (c) What do the answers to Parts 2(a) and 2(b) tell you about Colins and Jezebels sold games? someone help plzzzzz The tip of the fan blade is 0.61 m from the center of the fan. The fan turns at a constant speed and completes 2 rotation every 1.0s The Progressive movement was a response to ______. A) European Imperialism and American expansionism overseas B) the effects of rapid industrialization, immigration, and urbanization C) increased governmental involvement in people's lives