Which best describes why the United States wanted to avoid invading Japan in a ground war? The US did not have Allied support for a ground war. The US wanted to prevent more war casualties. The US did not have the resources to fight in this way. The US knew it could not win a ground war.

Answers

Answer 1
 The US wanted to prevent more war casualties.
Answer 2

The correct answer is "The US wanted to prevent more war casualties". During World War II Japan attacked the US in multiple occasions which could had provoked that US responded by a ground attack. However at that time the government did not want to cause more war casualties and preferred to respond to Japan attacks in different ways, but avoiding ground attacks.


Related Questions

What did the british call the boston massacre?

Answers

The incident on King Street
hope I help

What was significant about the timing of the battle of new orleans?

Answers

The Battle of New Orleans was the last major battle of the War of 1812. It happened on January 8, 1815, although it was preceded by smaller skirmishes. Under the command of General Andrew Jackson, American forces successfully repelled the invading British army (led by General Edward Pakenham).

list three things now made possible by cheaper steel

Answers

Airplanes, skyscrapers, car frames

Which BEST describes why participating in public debates and discussions is a way for citizens to nurture themselves in society? A) It helps citizens better compete in international competition. B) It raises citizens' awareness of political and social issues. C) It makes everyone in a society agree about every issue. D) It causes the government to do whatever citizens want.

Answers

the answer is to the question should be B

Participating in public debates and discussions is a way for citizens to nurture themselves in society, It raises citizens' awareness of political and social issues. Hence, option (B) is correct.

What are citizens?

The term citizen can be referred to that A citizen is a person who, by place of birth, nationality of one or both parents, or naturalization, is granted full rights and responsibilities as a member of a nation or political community. By living in their countries for many years, citizenship can also be granted.

By participating in the debates and the discussion, more awareness can be spread, and know more about the conclusion can be formed and make progress in it by speaking in public the more knowledge about things can be clarified. By citizens.

Therefore, option (B) is correct.

Learn more about citizens here:

https://brainly.com/question/455363

#SPJ2

When did christopher sholes invented the typewriter?

Answers

feb 14 1819 hope this helps

Final answer:

Christopher Sholes invented the typewriter in 1867, which included the QWERTY keyboard and revolutionized office productivity.

Explanation:

Christopher Sholes perfected the typewriter in 1867, paving the way for a more efficient means of writing. His design included the standard QWERTY keyboard, which has remained a steadfast element in typing devices to this day.

This innovation, occurring in the midst of a transformative period in communications technology, offered a faster and cleaner method to type messages and documents, significantly impacting office productivity and job opportunities for women.

A(n) _____ is the highest educational degree available at a community college. master, bachelor, associate, or specialist

Answers

Masters degree depending on which school


Answer:

associate

100 odyssey ware

Which of the following crops is grown at lower elevations?

Answers

well you have nothing listed but I know sugar cane is grown at lower elevations

Answer:

bananas

Explanation:

Which power did farmers merchants and artisans eventually gain in the Roman republic

Answers

A. The ability to elect officials who could veto laws harmful to plebeians

Answer:

The ability to elect officials who could veto laws harmful to plebeians

Explanation:

Which action might a government take if a nation has high levels of imports?

Answers

THE ACTION THAT A GOVERNMENT MIGHT TAKE IF A NATION HAS A HIGH LEVELS OF IMPORTS WOULD BE TAXING IMPORTED GOODS TO HELP DOMESTIC BUSINESSES
taxing important goods to help domestic business 

The process of allocating congressional seats among the 50 states is called

Answers

The process of allocating congressional seats throughout the 50 states in the United States is called "reappointment." In 1929, Congress passed a bill known as the Reappointment Act of 1929. The act combined pulling numbers from the US Census and a reapportionment bill. The purpose was to find a permanent method for apportioning the congressional seats.

How many amendments have been made to the Constitution since its ratification?

Answers

Up to current day, 27 amendments have been made since the ratification of the Constitution.
27 amendments 
hope it helps

What is the difference between ignorance and apathy worksheet answer key?

Answers

I think there is a big difference between the two. Ignorance is the lack of knowledge on certain things. If you teach an ignorant person, he or she can learn and not be ignorant anymore. Apathy is the lack of enthusiasm or emotions for certain things. In this sense, it's hard to make a person listen if they do not find it interesting.People leaning towards apathy can be very difficult to convince.
Final answer:

Ignorance refers to a lack of knowledge while apathy refers to a lack of interest. Both Socratic and Indian philosophers link ignorance to harm or suffering and propose enlightenment as a remedy.

Explanation:

The difference between ignorance and apathy primarily lies in what they signify. Ignorance refers to a lack of knowledge, understanding, or awareness about something. Conversely, apathy refers to a lack of interest, concern, or enthusiasm in something. It's possible for someone to be ignorant about a topic but not necessarily apathetic, as they may still show interest in learning about it. Likewise, someone might be informed about a subject yet display apathy by not caring about it.

In the context of Socrates' and Indian philosophers' views, ignorance is closely tied to harm or suffering. Socrates sees harm as a product of ignorance, proposing that nobody intends to do evil, but it emerges because of a lack of knowledge. In comparison, Indian philosophers also correlate suffering and ignorance, stating that suffering arises from attachment to temporary things resulting from ignorance. In this sense, enlightenment is the remedy for ignorance.

Learn more about Ignorance vs Apathy here:

https://brainly.com/question/6031076

#SPJ11

When did states start allowing all white males to vote?

Answers

they have always allowed white males to vote

Which is an example of Peter the Great’s legacy?

Answers

He expanded Russian territory.
Answer:

Peter the Great was conceived on June ninth 1672 and kicked the bucket on February eighth, 1725. He left the Russian Empire with an inheritance brimming with achievements. His principal objective was to westernize Russia and turned into a power on the planet.

He was the principal Tsar to sort out a standing armed force for Russia. When he extended his domain to the Baltic coast, he constructed the city of St. Petersburg, Russia's initially warm-water port. That prompted the production of Russia's first naval force. He likewise revamped the legislature to be increasingly European.

He included the Senat, the most elevated government organization. He likewise included 10 semi-services called "Kollegii." He presented the survey charge which gave subsidizing for a functioning remote approach and helped national assembling and exchange.

Although not invented by the phoenicians, the idea of _______ was passed on by them.

Answers

The concept of an alphabet was passed on by the Phoenicians. The Phoenician alphabet is thought to be conceptualized from ancient Egyptian hieroglyphs. Some of the earliest inscriptions can be found on the sarcophagus of King Ahiram (~1200 BC).

What do you consider to be the key characteristic of the early roman republic? why?

Answers

Their strong military and powerful government.The Roman Republic was dominated by an aristocracy. They had legal slavery and few rights were given to those without money and power.The early Roman Republic was marked by a series of external and internal conflicts. Perhaps the most notable external conflicts included those against the Gauls.

Final answer:

The early Roman Republic's key characteristic was its democratic government based on written laws and individual liberties. Modern governments, like the United States, reflect these republican principles. The downfall of the Roman Republic due to wealth and power issues provides lessons for modern republics.

Explanation:

The key characteristic of the early Roman Republic was its foundation on a system of government that included elements of democracy, such as the presence of written laws, separate branches of government, and voting power held by male citizens. These features reflected the principles of libertas (liberty) that Romans valued.

In modern governments, especially evident in the United States system, we can see echoes of these republican principles, such as the importance of a constitution, the rule of law, the division of powers, and the emphasis on individual liberties.

The eventual downfall of the Roman Republic was influenced by various factors, including issues related to wealth and power distribution, which led to societal unrest and political instability. While modern republics like the United States face different challenges, the lessons from Rome highlight the importance of addressing inequalities and ensuring the active participation of citizens in governance to prevent similar collapses.

What did the suez crisis show about power in the cold war apex?

Answers

Even if the Soviet Union and the United States were not directly involved, the cold war influenced decisions.

The right answer is: The united States and the Soviet Union held the balance of power.

How did the reform act of 1832 change parliament?

Answers

-Redistributed seats in the House of Commons

-More suffrage for working class men

-Less property qualifications required for voting
1. It extended suffrage to the middle classes who had been rising in wealth and power since the start of the Industrial Revolution
2. The act also aimed to re-evaluate constituent areas, new fast growing cities like Manchester and Liverpool
3. The act can be seen as a way of accepting the middle class into the political arena before the middle and working classes could unite and pose a serious threat to the upper classes in charge of parliament.


This is what I know! Hope this helps :)

Belief that government is designed to promote the public good describes the ______ political culture.

Answers

belief that government is designed to promote the public good describes the moralistic political culture.

God bless!

how did the big business change to the end of nineteenth century

Answers

The Industrial Revolution. It added many machines and factories which in turn provided many jobs for many Americans.
Final answer:

The end of the nineteenth century marked a significant shift in big business. Industrialization and technology advancement birthed a new wave of business magnates who challenged the traditional power structure, leading to significant social and economic changes, including the development of labor unions and employee rights legislation. Infrastructure developments like railroads also bolstered the growth of various industries.

Explanation:

The big business changed dramatically towards the end of the nineteenth century due to two main factors: industrialization and the innovation of new technologies. Industrialization led to urban growth and increased the potential for federal centralization. This crystalized into a regulatory framework in the early twentieth century

Simultaneously, advancements in steel refining, communications, and electricity transformed the business landscape. Families like the Rockefellers and Vanderbilts capitalized on these changes to challenge the traditional aristocratic power structure, becoming highly influential in business and government.

Their operations were not without controversy. Many of these business magnates were known as 'robber barons' due to their ruthless business tactics. However, irrespective of their reputations, these individuals revolutionized American industry and changed its social structure significantly. Their actions laid the groundwork for the formation of labor unions and employee rights legislation.

Additionally, infrastructure developments like the expansion of the railroad industry were key. As the nation's first 'big business', railroads were instrumental in accelerating the growth of other industries.

Learn more about Big Business here:

https://brainly.com/question/19146938

#SPJ2

True or false. puritans decline partially as a result of the witch hunts.

Answers

I believe the answer to your question is: True

To protect settlers in new mexico, the spanish paid comanche and navajo allies to attack the _____.answer

Answers

To protect settlers in New Mexico the Spanish paid Comanche and Navajo allies to attack the Apaches. 

They paid the allies to attack the Apaches.

Compare and contrast Walter Mitty and his Wife

Answers

Well as far as comparing you could put walter Mitty likes this but his wife likes this hoped this helped

Why would church and religious life had a great appeal

Answers

Religion gives people meaning. They are living to please something other than people. People also become religious to become better people and live better lives.

Hope that helps!
-Chris

What was the effect of abraham lincoln winning the election of 1860?

Answers

Lincoln's election led to the start of the Civil War though Lincoln had claimed clearly that he would not abolish slavery.  hope this helps

The CivilWar was the answer for the question

Which northern european humanist wrote a book that imagined a peaceful society without private property?

Answers

You are probably talking about the book Utopia written by Sir Thomas More, which is considered a saint in the Roman Catholic Church and Anglican Communion. Thomas More was an English lawyer and a noted Renaissance humanist that served the court of Henry VIII of England. In the Utopia, More described a fictional island society with ideal religious, social, and political customs. The society is perfectly orderly, with very simple laws, and social gatherings in public view so participants will behave. Communal ownership supplants private ownership, men and women receive good education, and there is good degree of religious toleration. The Utopia is More’s most famous work.

Answer:

Sir Thomas More

How does the system of checks and balances lead to conflict between the president and congress?

Answers

The system of checks and balances lead to conflict between the president and Congress by the fact that members of Congress often have ideas very different from the president about what constitutes desirable public policy. Hope this helps you! Please mark brainest!

What claims could the British and Americans lay to the Oregon Territory?

Answers

Oregon Territory was originally claimed by Great Britain, who, under their claim, established successful trade outposts such as the Hudson Bay Company, etc. However, during the course of westward expansion(manifest destiny, whatever), after Lewis and Clark's exploration of Oregon Territory, many Americans settled the Oregon territory, including missionaries and fur trappers, who of course set up shop. In the end, the American claim was stronger, as you can see, Oregon isnt influenced by Britain like parts of Canada are now.

What happened to the unemployment rate after the stock market crash in 1929

Answers

"The Great Depression lasted from1929 to 1939, and was the worst economic downturn in the history of the industrialized world. It began after the stock market crash of October1929, which sent Wall Street into a panic and wiped out millions of investors." I hope this helps you answer your question ! :)

Answer:

What happened to the unemployment rate after the stock market crash in 1929

Explanation:

What happened with the unemployment rate to the fall of the Stock Exchange in 1929, was that it increased.

They fell: National income, tax revenues, corporate profits and prices. International trade declined, and unemployment increased.

Which of these statements best describes the intent of the framers of the constitution when they created the office of the president?

Answers

They wanted cheese very badly:)

A) The intent of the framers of the constitution when they created the office of the president was to establish a strong executive branch capable of leading the nation effectively.

The framers of the constitution recognized the need for a central authority to oversee the execution of laws and the management of the country's affairs. They intended for the president to serve as the head of this executive branch, responsible for enforcing laws, managing foreign affairs, and representing the nation's interests both domestically and internationally. This vision reflected their desire for a capable leader who could provide stability and direction to the young nation.

- The framers aimed to create a strong executive branch to ensure effective governance.

- They envisioned the president as a leader capable of making decisions and implementing policies for the benefit of the nation.

- This approach was intended to prevent the government from becoming paralyzed by indecision or factionalism, thereby promoting stability and progress.

The complete Question is given below:

Which of these statements best describes the intent of the framers of the constitution when they created the office of the president?

A) To establish a strong executive branch capable of leading the nation effectively.

B) To create a figurehead with limited powers who would serve primarily as a ceremonial leader.

C) To prevent the concentration of power in a single individual by establishing a system of checks and balances.

D) To ensure that the president would be directly elected by the people, reflecting the will of the majority.

Other Questions
which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Steam Workshop Downloader