richerds checkbook awnsers as of 02/19

Answers

Answer 1
what is the question and do you know how to spell (i am saying that in the nicest way possible)

Related Questions

what is 3,996 + 7899

Answers

3996 + 7899 = 11895

:)
it equals up to  11895 

A boat moves 60 kilometers east from point A to point B. There, it reverses direction and travels another 45 kilometers toward point A. What are the total distance and total displacement of the boat?

Answers

The total displacement of the boat is therefore 15 kilometers east.

The student is asking about calculating the total distance and displacement of a boat after it has traveled in two opposing directions. To find the total distance, we simply add up the lengths of both trips the boat makes. Since the boat moves 60 kilometers east from point A to point B and then reverses direction to travel another 45 kilometers towards point A, the total distance traveled by the boat is the sum of these two trips:

Distance from A to B = 60 kilometersDistance from B to A = 45 kilometersTotal distance = 60 km + 45 km = 105 kilometers

The total displacement, however, is the vector difference between the final and starting positions. Since displacement is directional, we calculate it by subtracting the westward trip from the eastward trip:

Displacement = 60 km (east) - 45 km (west)Since east is the positive direction, the displacement is 60 km - 45 km = 15 km towards the east

The total displacement of the boat is therefore 15 kilometers east.

Gcf of 24 60 and 72 i need it for my test tomorrow

Answers

The greatest common factor is 12.

If is equal to 0.73, then is equal to ______.

0.73

0.50

0.33

0.27

Answers

The answer that seems to make the most sense is 0.27

A spherical water tank holds 10500ft^3. What is the diameter of the tank? Use V=pie/6*d^3

Answers

The diameter is about 27.17 ft

The diameter of the sphere having a volume 10500 ft³ is 27.2 feet.

What is a sphere?

In geometry, a sphere is a three-dimensional solid figure, which is round in shape.

The surface area is 4πr².

The volume is (4/3)πr³.

The diameter is 2×radius of the sphere.

Given, A spherical water tank holds 10500ft³.

The formula for the volume of the sphere is to be used is V = (π/6)d³, where 'd' is the diameter.

Therefore,

(π/6)d³ = 10500.

d³ = (10500)×(6/π).

d³ = 20063.7

d = 27.2 feet.

learn more about sphere here :

https://brainly.com/question/11374994

#SPJ2

HELP PLEASE?!???
???????

Answers

Negative because it can't be nothing bigger
Answer is negative. If the arrow is Starting from the top left and then the 2nd is pointing down towards the bottom right, it is negative. Positive Is the complete opposite where the arrow is starting from bottom left and moving up toward the top right. Negative= slanted down, positive= slanted up. Now 0 is when it is just a horizontal line and undefined is a vertical line.

Using the figure above, if< A  = <D, then< B ___ <E.
Choose the relationship symbol that makes the statement true.

Answers

Answer:

The relationship symbol that makes the statement true is '>'.

Step-by-step explanation:

Given,

In triangles ABC and EDF,

∠A = ∠D

Since, the sum of all interior angles of a triangle is supplementary,

⇒ ∠A + ∠B + ∠C = 180° and ∠D + ∠E + ∠F = 180°

⇒ ∠A = 180° - ∠B - ∠C and ∠D = 180° - ∠E - ∠F,

By substituting the values,

180° - ∠B - ∠C = 180° - ∠E - ∠F

- ∠B - ∠C = - ∠E - ∠F

∠B + ∠C =  ∠E + ∠F

∠B + 20° =  ∠E + 30°  ( given ∠C = 20° and ∠F = 30° )

∠B  =  ∠E + 10°  

∠B > ∠E

Hence, the relationship symbol that makes the statement true would be '>'.

What is the eighth term in the arithmetic sequence defined by the explicit formula an=2n+7

Answers

2*8+7=23..........................

Answer:

a8= 23

Step-by-step explanation:

Which pairs of angles below are alternate interior angles? Check all that apply.


A. ∠1 and ∠3
B. ∠7 and ∠2
C. ∠4 and ∠5
D. ∠8 and ∠2
E. ∠6 and ∠4
F. ∠7 and ∠1

Answers

F,F is the answer i believe
I am pretty sure B is the correct answer.

A grocery store bought milk for $2.70 per gallon and stored it in two refrigerators. During the night, one refrigerator malfunctioned and ruined 13 half gallons. If the remaining milk is sold for $4.04 per half gallon, how many half gallons did the store buy if they made a profit of $62.72?

Answers

so they bought x half gallons at $1.35 each ($2.70 per gallon). so their cost was:
C = 1.35x
Their revenue was the remainder of the milk (x - 13 that ruined) times the price:
R = 4.04(x - 13) = 4.04x - 52.52
The profit is Revenue - Cost
P = R - C = 4.04x - 52.52 - 1.35x = 2.69x - 52.52
Now we know they made 62.72 profit, so:
2.69x - 52.52 = 62.722.69x = 115.24x = 42.84 or about 43 half gallons

What is the least common denominator of 5/12 and 4/9

Answers

36. That is the LCD of 12 and 9.

A copy machine makes 32 copies per minute. How long does it take to make 120 copies?

Answers

That'd take 3.75 minutes, about 4 minutes.
the answer is four minutes

The planets move around the sun in elliptical orbits with the sun at one focus. The point in the orbit at which the planet is closest to the sun is called perihelion, and the point at which it is farthest is called aphelion. These points are the vertices of the orbit. A planet's distance from the sun is 224,000,000 km at perihelion and 232,000,000 km at aphelion. Find an equation for the planet's orbit. (Place the origin at the center of the orbit with the sun on the x-axis. ...?

Answers

[tex]a= \frac{224,000,000+232,000,000}{2} =228,000,000 \\e=228,000,000-224,000,000=4,000,000 \\e^2=a^2-b^2 \\b^2=a^2-e^2=228,000,000^2-4,000,000^2=228^2\times10^{12}-4^2\times 10^{12} \\b^2=(228^2-4^2)\times10^{12}=51,968\times 10^{12} \\b^2=5.1968\times10^{16} \\ \\ \frac{x^2}{5.1984\times 10^{16}} + \frac{y^2}{5.1968\times10^{16}} =1[/tex]

Rishi Maharan’s charge account statement shows an unpaid balance of $6,752.22. The monthly finance charge is 1.85% of the unpaid balance. After the finance charge was applied, Rishi has made new purchases of $150.75. What is the new account balance?

$7,027.89
$7,030.67
$6,902.97
$6,877.14

Answers

I thinhk..
6,752.22 + (6,752.22 x 1,85%) + 150.75 = 7,027.89 

The requreid new account balance is approximately $7,027.89, which is option A.

What is a finance charge?

A finance charge is a fee charged by a lender or creditor for the use of credit or the extension of existing credit. It is typically calculated as a percentage of the unpaid balance on a credit account or loan and is added to the account balance as an additional cost to the borrower.

The finance charge can be calculated as:

1.85% of $6,752.22 = 0.0185 x $6,752.22 = $124.98

Adding this finance charge to the unpaid balance gives:

$6,752.22 + $124.98 = $6,877.20

Finally, adding the new purchases to this balance gives:

$6,877.20 + $150.75 = $7,027.95

So, the new account balance is approximately $7,027.89, which is option A.

Learn more about finance charges here:

https://brainly.com/question/2588555

#SPJ2

work out the value of 5x-2y when x=-2 and y=-3

Answers

I guess this how it would go
(5)(−2)−(2)(−3)

So your answer should be −4

What is the product?

(5r + 2)(3r − 4)

15r2 + 8
15r2 − 8
15r2 + 14r − 8
15r2 − 14r − 8

Answers

The answer is 15r to the 2nd power -14r - 8, so the answer is D).

15r to the 2nd power - 20r + 6r - 8 ( I Used the FOIL method)

15r to the 2nd power + (-20r + 6r) - 8 (Gather like terms)

15r to the 2nd power - 14r - 8 (Simplify)

15r² -14r -8  is the product of (5r + 2)(3r − 4). Thus, option D is correct.

What is a product?

A product is an outcome of multiplying two or more numbers in mathematics. It is a crucial idea in algebra and is applicable to solution-solving.

The multiplication sign (x) designates the product, which is typically represented by a mathematical formula or a statement. The item is able to be employed to solve equations and discover their unsolved values.

= (5r + 2)(3r − 4)

= 5r(3r − 4) +2(3r − 4)

= 15r² - 20r + 6r - 8

= 15r² -14r -8

Therefore, option D is the correct option.

Learn more about product, here:

https://brainly.com/question/29652804

#SPJ7

.

Use the graph of the function h below to find the following.All values at which h has a local minimum
All local minimum values of h
If there is more than one answer, separate them with commas.
Don't want an answer, just want to know what I'm looking for, maybe an example.

Answers

The local minimum values of h are -3 and 0, and occur at the points (-2,-3) and (3,0).

From the graph, we can see that:

Local minimum values of h occur at (-2,-3) and (3,0)

Local minimum values of h are -3 and 0 respectively.

To find the local minimum values of h, we look for the points on the graph where the function changes from decreasing to increasing. These points are called local minimums.

From the graph, we can see that h changes from decreasing to increasing at the points (-2,-3) and (3,0). Therefore, these are the local minimum values of h.

For such more questions on local minimum

https://brainly.com/question/2437551

#SPJ6

Find the most general antiderivative of the function.
g(t) = (5 + t + t^2)/ square root of t

Answers

g(t) = (5 + t + t^2) / √t = 5/√t + √t + t√t
∫g(t)dt = ∫(5√t + √t + t√t)dt = 5(t)^3/2 / 3/2 + t^3/2 / 3/2 + t^5/2 / 5/2 + c = 10/3 t√t + 2/3 t√t + 2/5 t^2√t + c
Final answer:

To find the most general antiderivative of the function g(t) = (5 + t + t^2) / sqrt(t), rewrite the function using inverse trigonometric functions and integrate it with respect to x, before substituting x back in terms of t to get the most general antiderivative.

Explanation:

To find the most general antiderivative of the function, g(t) = (5 + t + t^2) / sqrt(t), we can rewrite the function using inverse trigonometric functions. Let x = sqrt(t), then t = x^2. Substituting this into the function gives us g(x^2) = (5 + x^2 + x^4) / x. Now, we can integrate this function with respect to x to find the antiderivative. The antiderivative of (5 + x^2 + x^4) / x is 5x + (x^3/3) + (x^5/5) + C, where C is the constant of integration. Finally, we substitute x back in terms of t to get the most general antiderivative of g(t).

Learn more about Antiderivative here:

https://brainly.com/question/31396969

#SPJ6

Which is the conclusion of this statement?

If a and b are negative, then a + b is negative.

A. If a and b are negative, then a + b is negative.
B. If a + b is negative, then a and b is negative.
C. a and b are negative.
D. a + b is negative.

Answers

A. If a and b are negative, then a + b is negative.
D.
The conclusion is the second part of the statement.

Which function represents exponential decay?

f(x) =1/2 (3/2)^x

  f(x) =1/2 (-3/2)^x

  f(x) =4 (-2/3)^x

f(x) = 4 (2/3)^x

Answers

For this case we have a function of the form:
 [tex]y = A * (b) ^ x [/tex]
 Where,
 A: initial amount
 b: change of rate
 b> 1: the exponential function grows
 b <1: the exponential function decreases
 x: independent variable
 y: dependent variable
 We then have the following function:
 [tex]f (x) = 4 (2/3) ^ x[/tex]
 Where,
 [tex]b = 2/3 [/tex]
 As b <1 then the exponential function decreases
 Answer:
 
A function that represents exponential decay is:
 
[tex]f (x) = 4 (2/3) ^ x[/tex]

The function [tex]f(x) = 4 (2/3)^x[/tex] represents exponential decay, as the base of the exponent (2/3) is between 0 and 1.

The function which represents exponential decay is the one where the base of the exponent is between 0 and 1 (0 < b < 1). Out of the given options, [tex]f(x) = 4 (2/3)^x[/tex] represents an exponential decay function since (2/3) is a positive fraction less than 1.

In contrast, a base greater than 1, a negative base, or a base of 1 would not represent decay: a base greater than 1 represents exponential growth; a base of 1 would be constant (no growth or decay); and a base that is negative would not be a standard exponential decay because it would lead to oscillation between positive and negative values.

A rectangle is transformed according to the rule R0, 90º. The image of the rectangle has vertices located at R'(–4, 4), S'(–4, 1), P'(–3, 1), and Q'(–3, 4). What is the location of Q?

(–4, –3)
(–3, –4)
(3, 4)
(4, 3)

Answers

(4, 3) Is your answer. 

The location of Q in the rectangle is D. (4, 3).

How to illustrate the information?

Graph images undergo transformations, one of the types of transformations is rotations. Rotation is done when each point of the image rotates 90° around a point in a counterclockwise manner.

When rotation is done, (x,y) -> (-y,x), therefore when taking points from image to original then the reverse is done (-y,x) --> (x,y)

The coordinates of image point q' is (-3,4), hence, before rotation then the coordinates are (4,3).

Learn more about rectangle on:

https://brainly.com/question/25292087

#SPJ6

Every ten years, the Bureau of the Census counts the number of people living in the United States.  In 1790, the population of the U.S.  was 3.93 million.  By 1800, this number had grown to 5.31 million.  Write an exponential function that could be used to model the U.S. population y in millions for 1790 to 1800.  Write the equation in terms of x, the number of decades since 1790.

Answers

3.93 (million) + (5.31 million). y (3.91 M) + y (oth) = 1.

What is the solution to the equation below? 2(x - 3) = 2x 5?

Answers

2 ( x - 3) = 2x 5
2x - 6 = 10x
2x - 10x = 6
-8x = 6
x = -6/8
x = -3/4

So, final answer is -3/4

Hope it helped

what is √6 over √5 in simplest radical form

Answers

To start off, this fraction needs to be rationalized; you can't have a radical in the denominator. So, you multiply both the numerator & denominator by the same number (so as to not mess up the proportion of numerator:denominator; it's like multiplying by 1) & get the radical out of the denominator. What number would that be? sqrt5.
So we have (sqrt6/sqrt5)•(sqrt5/sqrt5).
To simplify that, we get (sqrt6•sqrt5)/(sqrt5•sqrt5).
This can be rewritten as:
sqrt(6•5)/sqrt(5•5)
= sqrt30/sqrt25
Now, sqrt25 = 5, so that problem is solved as such:
sqrt30/5
I'm thinking sqrt30 can't be simplified any further. If it can, do so.

Hope this helps!


Which statement correctly describes the end behavior of y = -3x5 + 5x2 +2x + 1


A)
The graph rises to the left and falls to the right.


B)
The graph falls to the left and rises to the right.


C)
The graph rises to the left and rises to the right.


D)
The graph falls to the left and falls to the right.

Answers

For this we can observe term -3x^5 because it is x to power of 5 and for bit larger values of x in positive direction and x in negative direction it is dominant that other terms.

if x decreases because power 5 is odd, x^5 will be negative and when multiplied by -3 it will be positive so it will rise to the left steaper and steaper.

if x increases, x^5 increases quickly and when multiplied by -3 will be negative. which means that it falls to the right.

Answer is A)

A total of 411 tickets were sold for the school play. They were either adult tickets or student tickets. The number of student tickets sold was two times the number of adult tickets sold. How many adult tickets were sold?

Answers

For problems like this, I usually divide the number by three
411/3 = 137 now that is the number of adult tickets add 137+137 = 274 that is the number of student tickets


The number of tickets sold to adults is 274 and of tickets sold to students is 137.

What is the system of equations?

A system of equations is a set of one or more equations involving a number of variables.

Let the number of tickets sold to adults be x.

And the number of tickets sold to students be y.

A total of 411 tickets were sold for the school play.

x + y = 411

The number of student tickets sold was two times the number of adult tickets sold.

x = 2y

Substitute the value of x in equation 1

[tex]\rm x + y = 411\\\\2y+y=411\\\\3y=411\\\\y =\dfrac{411}{3}\\\\y= 137[/tex]

Substitute the value of y in equation 2

[tex]\rm x = 2y\\\\x= 2\times 137 \\\\x =274[/tex]

Hence, the number of tickets sold to adults is 274 and of tickets sold to students is 137.

Learn more about the system of equations here;

https://brainly.com/question/21636882

#SPJ2

One book costs £2.98. how much do 4 books cost?

Answers

the answer to this would be 11.82

How do i prove lines are parallel

Answers

If I'm not mistaking parallel lines never touch
Corresponding Angles or Alternate Interior Angles 

2/17 = x/102 solve the proportion

Answers

2/17=x/102
times both sides by 102
204/17=x
12=x

If two triangles are congruent, then the six ___ parts are congruent.

Answers

If two triangles are congruent, then the six corresponding parts are congruent.

Answer:

If two triangles are congruent, then the six corresponding parts are congruent.

Step-by-step explanation:

If two triangles are congruent, then each part of the triangle is congruent to the corresponding part in the other triangle.

With reference to the above congruent triangle rule, we get;

If two triangles are congruent, then the six corresponding parts are congruent.

Other Questions
write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? Steam Workshop Downloader