Myofibrils are ______. specialized contractile organelles found in muscle cells, which occupy most of the cell volume the contractile proteins located within a muscle cell the boundaries of individual sarcomeres the basic contractile units of skeletal muscle tissue none of the descriptions is correct.

Answers

Answer 1
the answer is false description

Related Questions

Human growth hormone is a secreted protein that stimulates growth and cell reproduction. in the 1960s it was discovered that this was an effective treatment for a form of dwarfism. however, before it was genetically engineered, it was _____

Answers

The answer is that it was harvested from cadavers which are corpses of a body that is deceased—they are used before the treatment that is effective for dwarfism was genetically engineered and by this, there has been some studies and researches that has been found out when they harvested from the cadavers.

A female client presents to the health care provider's office with increasing stomach acidity. she self-administers calcium antacids. she notes that she seems to be having more issues with stomach acid, so she has been taking the calcium antacids more frequently. the nurse suspects that this may have caused what to occur in this client?

Answers

The nurse suspected that the client who seems to be having an issue with stomach acid, may have cause to what occur to the client is rebound acidity. Rebound acidity is an increase in gastric acid secretion basal or stimulated above pre-treatment levels following discontinuation of anti-secretory therapy.

Which set of body parts does every mollusk have?

Answers

Hello!

A mollusk is a snail in case you didn't know! Every single one has a foot, a Visceral Mass, and a head. A Visceral mass is like the body and it includes the organs.

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy.

The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.

The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.

Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.

Identify the medical term referring to a (head) cold:

Answers

The medical term referring to a head cold is coryza. The coryza occurs when an individual’s mucous membranes in their nasal cavity has a presence of inflammation in which will likely result into having a hay fever or causing a person to have a cold.

Final answer:

The medical term referring to a (head) cold is rhinorrhea, which is the excessive production of mucus in response to a viral infection. It is a common symptom of a cold and is often accompanied by sneezing, congestion, sore throat, and coughing.

Explanation:

The medical term referring to a (head) cold is rhinorrhea. Rhinorrhea is the medical term for a runny nose, which is a common symptom of a cold. It occurs when the nasal tissues produce excessive mucus in response to a viral infection. Other symptoms of a cold may include sneezing, congestion, sore throat, and coughing.

Learn more about Rhinorrhea here:

https://brainly.com/question/34319474

#SPJ6

similarities between outer planets and inner planets

Answers

the outer planets are big and cold but the inner planets have more warmth and in earths case LIFE

Your patient tells you he is a jehovah's witness. what should you do to show your support for his spiritual beliefs?

Answers

Get to know your patient, learn more about it. that will show that you support his/her believes.

Final answer:

To show support for a patient who is a Jehova's Witness, it is important to understand and respect their spiritual beliefs. Ask about their specific beliefs, align medical treatments with those beliefs, and provide relevant resources and connections.

Explanation:

If your patient identifies as a Jehova's Witness, it is important to respect and support their spiritual beliefs in your role as a healthcare provider. Here are some steps you can take to show your support:

Ask your patient about their specific beliefs and practices as a Jehova's Witness. This will help you understand their unique needs and preferences.Ensure that any medical treatments or procedures align with their religious beliefs. For example, Jehova's Witnesses may refuse blood transfusions due to religious reasons, so it is important to explore alternative treatment options.Provide resources and connect your patient with a medical team that has experience working with Jehova's Witnesses. This can help ensure that their spiritual beliefs are respected throughout their healthcare journey.

What to do during study hall when you have no homework?

Answers

You can do your homework, search for a project you may have, read etc
You should try doing something that will affect your grade by going up
1.study
2.finsish any missing asinements
3.study for a test
4.finish anything that's due
I hope this helps.. :)

What is the basic structural unit of both dna and rna?

Answers

The Nucleotide. DNA and RNA are both nucleus acids. Nucleic acids' monomer is called a nucleotide.

Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.

Answers

Is a hormone produced by the pancreas

Which of the following is generally true of female bones in relationship to male bones?

They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.

Answers

The are actually smoother!
b becuse there female ..........hope it helps

The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.

Answers

Generally the ear, and more specifically the cochlea

The ear is composed of 3 parts namely:
 1. The outer ("external") ear, composed of the pinna and ear canal, 
 2. The middle ear, composed of tympanic cavity and three ossicles, 
 3. The inner ear, composed of semicircular canals, the utricle, saccule, and the cochlea. 

Hearing happens initially by allowing the pinna of your ear to focus the sound. Then, by means of the ear canal and the ossicles, the sound is sent to the fluid-filled eardrum, which begins to vibrate. The vibrations are sent to the snail-shell looking component of the inner ear called the cochlea. The cochlea senses these vibrations and converts them to nerve impulses to be interpreted by the brain, making you "hear" the sound. 




As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration

Answers

D. Cellular Respiration

The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle

Answers

Hi Ash, thanks for asking a question here on Brainly!

The hard and brittle outer layer of the Earth is known as the lithosphere.

Answer: Letter B 

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or post another question and send the link to me. -UnicornFudge aka Nadia 

If ur doing studyisland the answer is (A) lithosphere

The processes of endocytosis and exocytosis both require?

Answers

require cells to expend energy

Answer: Uses vesicles

Which term means increasing the angle between two bones of the straightening of a limb?

Answers

extension- increasing the angle between two boned of the straightening of a limb

According to thelen (1986), which reflex may contribute to the birthing process? the stepping reflex the rooting reflex the grasping reflex. the startle reflex.

Answers

According to Thelen {1986}, THE STEPPING REFLEX may contribute to the birthing process.
Stepping reflex is one of the reflexes demonstrate by new born babies. When resistance is exerted on the feet of a new born baby, the baby will respond by placing one foot in front of the other, this is called stepping reflex and Thelen suggested that this reflex may help in the birthing process.

The correct reflex that may contribute to the birthing process according to Thelen (1986) is the stepping reflex.

Thelen (1986) discussed the role of neonatal reflexes in the context of development and their potential functions. Among these reflexes, the stepping reflex is particularly interesting because it can be observed when a newborn is held upright with their feet touching a solid surface; the baby will make stepping movements. This reflex is thought to be a vestige of our evolutionary past, where it might have helped the infant to crawl and find the nipple to suckle shortly after birth.

While the stepping reflex is not directly involved in the process of birth itself, it is a reflex that emerges immediately after birth and could theoretically aid the infant in moving towards the mother's breast for feeding, which is an important aspect of the postnatal period. The other reflexes mentioned serve different purposes:

- The rooting reflex helps the baby find the nipple when the cheek is stroked.

- The grasping reflex occurs when the palm is stroked, causing the baby to grasp firmly.

- The startle reflex, also known as the Moro reflex, is a response to loud noises or the sensation of falling, where the baby throws out their arms and then pulls them back in.

A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False

Answers

False

In order to happen sexual reproduction, the cells that origin gametes must have an even number of chromosomes. By crossing a tetraploid (4n) with a diploid (2n), the offspring would have a total number of 3 copies of each chromosome (2 from the tetraploid parent and 1 from the diploid parent), which when undergoing sexual reproduction would not allow meiosis to happen because the chromosomes could not be evenly divided to gamete cells.

The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?

Answers

The statement that the nurse best response in the client who has diagnose with type 2 diabetes mellitus eats a lot of pasta products is "Pasta can be a part of your diet. It's included in the bread and cereal exchange." So the nurse may say that pasta should be part of the client diet because it includes in the bread and cereal exchange.

Which statement best describes the population at point D? A.The carrying capacity has been reached. B.The population density is very low. C.The birthrate is very low. D.There is unlimited food and space.

Answers

I think it might be either A or B. Hope this helped. Have a great day! :D
A. The carrying capacity has been reached. 

As you can see from the graph that there is a red dotted line (Carry capacity) and at D. this has been met.

Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought hit the region and the vegetation dried up. Over time, grasses were observed in the region. Shortly thereafter, an increase in short-necked tortoises was observed in the region. What does this change in the species of tortoises suggest?

Answers

Answer:

A.  

Changes in the environment give rise to evolution of species.

Explanation:

I just did this on PLATO and I got 100%

Final answer:

The change in the species of tortoises suggests natural selection, where tortoises with shorter necks became more abundant in a region with grasses after a drought.

Explanation:

This change in the species of tortoises suggests natural selection at play. In the given scenario, tortoises with long necks were more abundant in regions with higher-level vegetation. This is because their longer necks allowed them to reach and access more leaves for food. However, when a drought hit the region and the vegetation dried up, grasses started to grow. As a result, short-necked tortoises had an advantage as they could easily access the grasses. Over time, these short-necked tortoises became more prevalent in the region.

The antibody molecule is held together by ________ bonds.

Answers

It is the disulphide bond. 

The fitt principle is applied to physical activity and exercise. what does fitt represent

Answers

Frequency, Intensity, Time, and Type.
Final answer:

The FITT principle represents Frequency, Intensity, Time, and Type, which are guidelines for creating an effective physical exercise program to enhance physical fitness and good health.

Explanation:

The FITT principle is a set of guidelines that can help you structure a physical exercise program effectively. FITT stands for Frequency, Intensity, Time, and Type:

Frequency refers to how often you engage in physical activity or exercise.Intensity indicates how hard you exercise during a workout session.Time refers to the duration of each exercise session.Type means the kind of exercise you do to improve or maintain physical fitness and overall good health.

Employing the FITT principle helps ensure that the workouts you perform are balanced and cover all aspects necessary for a comprehensive fitness program. This can include a combination of cardiovascular exercises, strength training, and flexibility workouts.

How can blimps be of use in scientific studies of the air?

Answers

Blimps are efficient vehicles for holding a wide range of scientific instrumentation at various altitudes that scientists can choose. They could measure barometric pressures, temperature, concentrations of specific chemicals using special equipment, humidity using hygrometers, et cetera. Blimps also could be used to track air currents since blimps drift as they are pushed by winds.

Where is the youngest crust material found on Earth?

Answers

underwater mountain chains called also known as mid-ocean ridges

Answer:

At divergent boundaries in the middle of the ocean (mid-ocean ridges)

=)

We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different

Answers

Hormones are the chemical messengers of the endocrine system and are transported by blood to distal target cells.Neurotransmitters are the chemical messengers found in the nervous system that specifically do the transmission across the synaptic cleft, where the space exists between two axons.They both carry messages but belong to different systems of the body.

Final answer:

Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.

Explanation:

Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.

Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.

What has uekaryotik cells liver, virus, oak, lactobacillus?

Answers

Eukaryotic cells have chromosomes, a membrane-bound nucleus, and membrane-bound organelles, practically any living thing. Eukaryotic cells are also considered animal cells. 

It could be both liver and oak
It could also just be liver if it specifies eukaryotic animal cells. 

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

dge78wdgqwe8fguefuqefioequf9be

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6

The nurse is used to working on the postpartum floor taking care of women who have had normal vaginal births. today, however, the nurse has been assigned to help care for women who are less than 24 hours post cesarean birth. the nurse realizes that some areas will not be assessed. what would the nurse leave out of the client assessments

Answers

The answer is perineum, usually a woman who experiences cesarean birth does not have an episiotomy though seldom this may be the case. In addition, perineum is the area among the anus and the scrotum in the male and among the anus and the vulva the labial opening to the vagina in the female. An episiotomy is a surgical process to expand the outlet of the birth canal to ease delivery of the baby and evade a sharp rip of the perineum.

What is one major impact of seedless vascular plants?

Answers

By far the greatest impact of seedless vascular plants on human life, however, comes from their extinct progenitors. The tall club mosses, horsetails, and tree-like ferns that flourished in the swampy forests of the Carboniferous period gave rise to large deposits of coal throughout the world.

The vascular seedless plants are utilized as the medicinal plant and fertilizer.

Further Explanation:

The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.

The characteristics of Pteridophytes:

1. They are seedless and vascular cryptogams: They reproduces through the production of spores.

2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.

3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.

4. Sex organs are multicellular and are jacketed.

Some of the example of Pteridophytes are:

1. Equisetum

2. Salvinia

3. Dicksonia

4. Selaginella

The importance of pteridophytes:

1. They are used as cattle feed

2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.

3. Marsilea contains starch and are consumed by people as food in some areas.

4.  Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.

Learn more:

1. Learn more about plant https://brainly.com/question/862697

2. Learn more about photosynthesis https://brainly.com/question/873199

3. Learn more about food https://brainly.com/question/1251757

Answer Details:

Grade: College Biology

Subject: Biology

Chapter: The Plant Kingdom

Keywords:

Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.

How would earth's atmosphere change if plants stopped carrying out photosynthesis?

Answers

the plant would no longer put out oxygen, and the concentration of carbon.
the atmosphere would no longer have oxygen and carbon. 
Other Questions
The graph shows the percentage of business-related jobs that deal with big data from November 2014 through September 2015. If the trends continue, what is likely to be the percentage of jobs related to big data by 2020? Which of the following is equivalent to 3^4?A) 7B) 12C) 64D) 81 What was sexism like in 1930's America What is thirty-four thousand centimeters per second in scientific notation An elevator accelerates upward at 1.2 m/s 2 . the acceleration of gravity is 9.8 m/s 2 . what is the upward force exerted by the floor of the elevator on a(n) 76 kg passenger? answer in units of n. "At a college, 4/5 of the students take an english class. Of these students, 5/6 take composition. Which fraction of the students at the college take compostion a line that passes through two sides of triangles divides the sides proportionally A. always B. sometimes C. never 2. What is the purpose of Douglass describing the better treatment of the city slaves compared to the plantation slaves in the Narrative of the Life of Frederick Douglass? At the local grocery store, lemons are 52 cents each each and lines are 21 cents each . How many lemons and limes can you but for exactly $3.75. This image is illustrating perspective. Which of the following techniques didthe artist NOT use to create this image?(1 point)vanishing pointhorizon lineorthogonal linesmonochromatic colors20 points Cellular respiration is a process involving the breakdown of glucose molecules in order to generate energy for cellular activities. Given the general reaction below, which of the following best describes the products labeled x and y? C6H12O6 + O2 _x___ + __y___ + energy A.The products are CO (carbon monoxide) and H2O2 (hydrogen peroxide), which then decompose into carbon dioxide (CO2) and water (H2O). B.The products are H2O (water) and CO2 (carbon dioxide), which then undergo anaerobic respiration. C.The products are CO2 (carbon dioxide) and H2O (water), which then become the reactants for photosynthesis. D.The products are O2 (oxygen) and H2O (water), which are then used for growth and to keep the organism hydrated. As a result of the Twenty-Second Amendment, presidents can: A.prevent pay raises for members of Congress. B.declare war without congressional approval. C.serve a maximum of two terms in office. D.veto constitutional amendments that have been approved by the states. the pressure exerted on the floor by the heel of someone's shoe is inversely proportional to the square of the width of the heel of their shoe. When Megumi wears 2cm wide heels, she exerts a pressure of 400 kPa. Determine a function to represent the pressure, p, exerted by Megumi if she wears heels of width, w. Jorge was reprimanded for an accounting error by his boss in front of his co-workers. jorge gets home from his job and yells at his wife for not having dinner ready. his wife then yells at the children for leaving their toys all over the house. this best illustrates the use of a defense mechanism known as: Mass movement is caused by By default, the document has a (blank) margin on all four sides What is the default margin width on all four sides of a document ? Which one of the following choices represents an incomplete protein? Which hormone stimulates the breakdown of polymerized glucose? Which term correctly identifies this part of a dermal (skin) cell?a) cytoplasm b) central vacuole c) chromatind) cytoskeleton Researchers have discovered that a moon rock brought back by the Apollo astronauts has a mass of 5.671 kg and a volume of 1,698 cm3. What is the density of the rock? Remember to use the correct number of significant digits in your answer. 3.3398 g/cm3 3.340 g/cm3 0.2994 g/cm3 3.3398 x 10-3 g/cm3